nhdf nucleofector kit (Lonza)
Lonza is a verified supplier 
Lonza manufactures this product 
90
Structured Review
Lonza
nhdf nucleofector kit
Nhdf Nucleofector Kit, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nhdf+nucleofector+kit/4d+nucleofector/bio_rxiv__2024__06__14__598925-451-43-43
Average 90 stars, based on 1 article reviews
Nhdf Nucleofector Kit, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nhdf+nucleofector+kit/4d+nucleofector/bio_rxiv__2024__06__14__598925-451-43-43
Average 90 stars, based on 1 article reviews
nhdf nucleofector kit - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Electroporation:Article Title: Dynamin1 long- and short-tail isoforms exploit distinct recruitment and spatial patterns to form endocytic nanoclusters Article Snippet: .. The Article Title: Genotype Complements the Phenotype: Identification of the Pathogenicity of an LMNA Splice Variant by Nanopore Long-Read Sequencing in a Large DCM Family Article Snippet: .. Briefly, 5 × 10 5 cells were subjected to electroporation using the Article Title: Genotype Complements the Phenotype: Identification of the Pathogenicity of an LMNA Splice Variant by Nanopore Long-Read Sequencing in a Large DCM Family. Article Snippet: .. Briefly, 5 × 105 cells were subjected to electroporation using the Plasmid Preparation:Article Title: Highly cooperative chimeric super-SOX induces naive pluripotency across species. Article Snippet: .. Human and cynomolgus macaque episomal reprogramming was done as previously described.173 Briefly, 5x105 human newborn foreskin fibroblasts (Young, Y),166 56-year-old male dermal fibroblasts (Old, O, Coriell, AG04148), or macaque fibroblasts (MHH Hannover) were nucleofected with 3 mg of plasmid DNA mix: pCXLE-SOX2-P2A-KLF4 (Addgene #193292) or pCXLE-SOX2-17P2A-KLF4 (Addgene #193290), pCXLE-L-MYC-F2A-LIN28 (ML, Addgene #27080), pCXLE-hOCT4-shTP53 (Addgene #27077), pCXWB-EBNA1 (Addgene #37624) using other:Article Title: Cytotoxic CD4 + T cells eliminate senescent cells by targeting cytomegalovirus antigen. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UL83 primer reverse: CGTTCATCAACAGGTTACCTGAGAT IDT N/A Human CIITA siRNA SMARTPool Horizon Discovery Cat#L-011083-00-0005 Negative Control siRNA Qiagen Cat#1022076 Software and algorithms Zen Blue 3 Zeiss https://www.zeiss.com/microscopy/en/products/ software/zeiss-zen.html FlowJo 10 BD Bioscience https://www.flowjo.co Prism 9 GraphPad https://www.graphpad.com/scientific-software/ prism/ Biorender Biorender https://biorender.com/ DESeq2 Bioconductor https://bioconductor.org/packages/ release/ bioc/html/DESeq2.html Seurat-4.3.0 Satija Lab https://satijalab.org/seurat/articles/ pbmc3k_ tutorial.html Cell Ranger-6.0 10x Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/using/tutorial_ov Other Zeiss Axio Observer Z1 Zeiss N/A Zeiss Axio Scan.Z1 Zeiss N/A Novaseq 6000 Illumine N/A LSRFortessa X-20 BD Bioscience N/A 7500 Real-Time PCR System Applied Biosystems N/A UVP XX-Series Bench Lamp 115V ThermoFisher Scientific UVP95004208 Hand-Held Light Meter InternationalLight Technologies ILT2400 SH800 Cell Sorter Sony Biotechnology N/A Cellometer Auto 2000 Nexcelom N/A C1000 Touch Thermal Cycler Bio-Rad N/A Qubit 4 Fluorometer Invitrogen Q32856 Agilent 4200 TapeStation Agilent Technologies G2991BA Nucleofector 2b Device Lonza AAB-1001 NanoDrop spectrophotometer NanoDrop Technologies ND-1000 ll |